Text and Characters - MATLAB & Simulink

Text in String Arrays

When you are working with text, enclose sequences of characters in double quotes. You can assign text to a variable.

t = "Hello, world";

If the text includes double quotes, use two double quotes within the definition.

q = "Something ""quoted"" and something else."

q = 

    "Something "quoted" and something else."

t and q are arrays, like all MATLAB^® variables. Their class or data type is string.

whos t

  Name        Size            Bytes  Class     Attributes
  t           1x1               174  string   

To add text to the end of a string, use the plus operator, +.

f = 71;
c = (f-32)/1.8;
tempText = "Temperature is " + c + "C"

tempText = 
"Temperature is 21.6667C"

Similar to numeric arrays, string arrays can have multiple elements. Use the strlength function to find the length of each string within an array.

A = ["a","bb","ccc"; "dddd","eeeeee","fffffff"]

A = 
  2×3 string array
    "a"       "bb"        "ccc"    
    "dddd"    "eeeeee"    "fffffff"

strlength(A)

ans =

     1     2     3
     4     6     7

Data in Character Arrays

Sometimes characters represent data that does not correspond to text, such as a DNA sequence. You can store this type of data in a character array, which has data type char. Character arrays use single quotes.

seq = 'GCTAGAATCC';
whos seq

  Name      Size            Bytes  Class    Attributes
  seq       1x10               20  char               

Each element of the array contains a single character.

seq(4)

ans = 
    'A'

Concatenate character arrays with square brackets, just as you concatenate numeric arrays.

seq2 = [seq 'ATTAGAAACC']

seq2 =
    'GCTAGAATCCATTAGAAACC'

Character arrays are common in programs that were written before the introduction of string arrays. All MATLAB functions that accept string data also accept char data, and vice versa.